Discover

Polymerase videos

Negative A - Polymerase Chain Reaction

http://www.discogs.com/release/1365028

polymerase chain reaction

Taq polymerase is used to replicate targeted portions of the genome during a cycle of heating and cooling. The process may be repeated thirty or forty times to get the right quantity of DNA by Gautam Rangan

Polymerase chain reaction (PCR)

polymerase chain reaction

Polymerase Chain Reaction

Procedure of polymerase chain reaction

Kary Mullis, father of Polymerase Chain Reaction (PCR)

Kary Banks Mullis, Ph.D. (born December 28, 1944) is an American biochemist and Nobel laureate. Mullis shared the 1993 Nobel Prize in Chemistry with Michael Smith. Mullis received the prize for his development of the Polymerase Chain Reaction (PCR), a reaction first described by Kjell Kleppe and 1968 Nobel laureate H. Gobind Khorana that allows the amplification of specific DNA sequences.[1] The improvements provided by Mullis have made PCR a central technique in biochemistry and molecular biology. Mullis also received the Japan Prize in 1993. Mullis was born in Lenoir, North Carolina, near the Blue Ridge Mountains,[2] on December 28, 1944. His family had a background in farming in this rural area. As a child, Mullis recalls, he was interested in observing biological organisms in the countryside.[1] He grew up in Columbia, South Carolina,[1] where he attended Dreher High School. Mullis earned a Bachelor of Science degree in chemistry[2] from the Georgia Institute of Technology in Atlanta in 1966 and received a Ph.D. in biochemistry from the University of California, Berkeley in 1973; his research focused on synthesis and structure of proteins.[1] Following his graduation, Mullis became a postdoctoral fellow in paediatric cardiology at the University of Kansas Medical School, going on to complete two years of postdoctoral work in pharmaceutical chemistry at the University of California, San Francisco. After receiving his PhD, Mullis left science to write fiction, then managed a bakery for two years.[3] Mullis returned to science at the encouragement of friend Thomas White, who later got Mullis a job with the biotechnology company Cetus Corporation of Emeryville, California.[3][1] Mullis worked as a DNA chemist at Cetus for seven years; it was there, in 1983, that Mullis invented his prize-winning improvements to the polymerase chain reaction.[4] After leaving Cetus in 1986, Mullis served as director of molecular biology for Xytronyx, Inc. for two years. Mullis has consulted on nucleic acid chemistry for multiple corporations.[3] In 1992, Mullis founded a business with the intent to sell pieces of jewelry containing the amplified DNA of deceased famous people like Elvis Presley and Marilyn Monroe.[5][6] Mullis was not the first to propose the ideas behind PCR. The main principles were described in 1971 by 1968 Nobel Prize laureate H. Gobind Khorana and Kjell Kleppe, a Norwegian scientist. Kleppe and Khorana released a 20-page research paper on PCR in the 1971 Journal of Molecular Biology. As early as June 18, 1969, Kleppe had presented his work at the Gordon Conference in New Hampshire. Using repair replication (the principle of PCR), he duplicated and then quadrupled a small synthetic molecule with the help of two primers and DNA-polymerase. Among the attendees[7] was Stuart Linn, who then used Kleppe's material in his own teachings to his students, including Mullis. The suggestion that Mullis was solely responsible for the idea of using Taq polymerase in the PCR process has been refuted by his co-workers at the time.[citation needed] However, other scientists have said that "the full potential [of PCR] was not realized" until Mullis' work in 1983,[8] and at least one book has reported that Mullis' colleagues failed to see the potential of the technique when he presented it to them.[5] As a result, some controversy surrounds the balance of credit that should be given to Mullis versus the team at Cetus.[3] In practice, credit has accrued to both the inventor and the company (although not its individual workers) in the form of a Nobel Prize and a $10,000 Cetus bonus for Mullis and $300 million for Cetus when the company sold the patent to Roche Molecular Systems. The anthropologist Paul Rabinow wrote a book on the history of the PCR method in 1996 (entitled 'Making PCR') in which he questioned whether or not Mullis "invented" PCR or "merely" came up with the concept of it. Rabinow, a Foucault scholar interested in issues of the production of knowledge, used the topic to argue against the idea that scientific discovery is the product of individual work, writing, "Committees and science journalists like the idea of associating a unique idea with a unique person, the lone genius. PCR is, in fact, one of the classic examples of teamwork."[9] In a Q&A interview published in the September, 1994, issue of California Monthly, Mullis said, "Back in the 1960s and early '70s I took plenty of LSD. A lot of people were doing that in Berkeley back then. And I found it to be a mind-opening experience. It was certainly much more important than any courses I ever took."[15] During a symposium held for centenarian Albert Hofmann, "Hofmann revealed that he was told by Nobel-prize-winning chemist Kary Mullis that LSD had helped him develop the polymerase chain reaction that helps amplify specific DNA sequences."[16]

Polymerase chain reaction (PCR) - WWW.OLOSCIENCE.COM

[Free download of my books on: WWW.OLOSCIENCE.COM] The polymerase chain reaction (PCR) is a technique widely used in molecular biology. It derives its name from one of its key components, a DNA polymerase used to amplify a piece of DNA by in vitro enzymatic replication. As PCR progresses, the DNA thus generated is itself used as a template for replication. This sets in motion a chain reaction in which the DNA template is exponentially amplified. With PCR it is possible to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of the DNA piece. PCR can be extensively modified to perform a wide array of genetic manipulations. Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus. This DNA polymerase enzymatically assembles a new DNA strand from DNA building blocks, the nucleotides, by using single-stranded DNA as a template and DNA oligonucleotides (also called DNA primers), which are required for initiation of DNA synthesis. The vast majority of PCR methods use thermal cycling, i.e., alternately heating and cooling the PCR sample to a defined series of temperature steps. These thermal cycling steps are necessary to physically separate the strands (at high temperatures) in a DNA double helix (DNA melting) used as template during DNA synthesis (at lower temperatures) by the DNA polymerase to selectively amplify the target DNA. The selectivity of PCR results from the use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions. Developed in 1984 by Kary Mullis,[1] PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications.[2][3] These include DNA cloning for sequencing, DNA-based phylogeny, or functional analysis of genes; the diagnosis of hereditary diseases; the identification of genetic fingerprints (used in forensic sciences and paternity testing); and the detection and diagnosis of infectious diseases. In 1993 Mullis won the Nobel Prize in Chemistry for his work on PCR.

Phire DNA polymerase

Phire DNA polymerase

Polymerase Chain Reaction

Polymerase Chain Reaction

PCR

PCR

RNA polymerase II domains

RNA polymerase II

DNA Test Methods - The Polymerase Chain Reaction

View the full Interactive Tutorial at: http://www.phgfoundation.org/tutorials/dna/4.html The polymerase chain reaction, or PCR, is a crucial method for exponentially increasing the amount of a specific DNA sequence. PCR is a cyclic process controlled by the temperature of the reaction mixture. First, the temperature is raised to 95°C (205°F), causing the template DNA to separate (denature). The temperature is then decreased to around 50°C (122°F), allowing short primer pieces of DNA to hybridise to each strand of the template at opposite ends of the sequence to be amplified. The thermostable enzyme Taq (a DNA polymerase that is active at high temperatures) then binds to and extends the primers at an intermediate temperature of 72°C (162°F), so that two new double-stranded copies of the template are made. This cyclic process of separating DNA strands, copying and reannealing the daughter strands is repeated multiple times to increase the numbers of DNA product.

Negative A - Polymerase Chain Reaction

I'm upploading Hardcore from 2008 Albums (Gabber) Subscribe to me = get acess to everything (i will send you on private message the link) And Visit: http://www.4shared.com/account/dir/8446702/8fc9a847/sharing.html?rnd=17 Download my mixes for some good hardcore to!

Polymerase Chain Reaction (PCR) Song

an hymn to the technique widely used in molecular biology

The Plastic Chord Live: Polymerase Chain Reaction (7 of 9)

The Plastic Chord Live: Polymerase Chain Reaction (7 of 9)

polymerase chain reaction

Thank you for seeing this art work. I experimentally made this music. If there is an opinion When it gives me the report, it is glad=) http://www.myspace.com/atsushi0103

Polymerase Chain Reaction

This is top-secret testing video from the agent they call Deniz H. For years, Euro-American intelligence have reported rumors of a special agent from the east with psychic powers. This video has been stolen from the Turkish government's Bureau of Psychic Warfare. Here, Deniz demonstrates his time manipulating powers by slowing down time while jumping. You can imagine the massive impact this secret knowledge will have on the current methods of war. I don't know how long the movie will stay online, because the Turkish spies are everywhere and trying to hunt down the video and those responsible for it's distrubution. So if you see this, record/download it and upload it on another website! The truth must prevail! S.S.

polymerase DNA

all of us ....

DNA Replication Process

http://www.FreeScienceLectures.com We travel inside nucleus to see how the DNA replicates. When DNA replicates its strands are separated by enzine helicase. Single-stranded DNA binding proteines keep the strands from (...?). One DNA strand encodes the leading strand using DNA Polymerase III. Just watch to see what is going on. --- It's Never too Late to Study: http://www.FreeScienceLectures.com --- Notice: This video is copyright by its respectful owners. The website address on the video does not mean anything. ---

DNA Replication (Very realistic 3D animation)

DNA replication is the process of copying a double-stranded DNA molecule to form two double-stranded molecules.[1][2] The process of DNA replication is a fundamental process used by all living organisms as it is the basis for biological inheritance. As each DNA strand holds the same genetic information, both strands can serve as templates for the reproduction of the complementary strand. The template strand is preserved in its entirety and the new strand is assembled from nucleotides. This process is called "semiconservative replication". The resulting double-stranded DNA molecules are identical; proofreading and error-checking mechanisms exist to ensure near perfect fidelity. ¤ In a cell, DNA replication must happen before cell division can occur. DNA synthesis begins at specific locations in the genome, called "origins", where the two strands of DNA are separated.[3] RNA primers attach to single stranded DNA and the enzyme DNA polymerase extends the primers to form new strands of DNA, adding nucleotides matched to the template strand. The unwinding of DNA and synthesis of new strands forms a replication fork. In addition to DNA polymerase, a number of other proteins are associated with the fork and assist in the initiation and continuation of DNA synthesis. DNA replication can also be performed artificially, using the same enzymes used within the cell. DNA polymerases and artificial DNA primers are used to initiate DNA synthesis at known sequences in a template molecule. The polymerase chain reaction (PCR), a common laboratory technique, employs artificial synthesis in a cyclic manner to rapidly and specifically amplify a target DNA fragment from a pool of DNA.

DNA. Amplification par PCR

L'amplification du DNA par PCR comporte la preparation d'un melange reactionnel contenant, entre autre, le DNA, les amorces (primers) et la DNA polymerase. L'amplification par PCR exige la dénaturation du DNA, la fixation des amorces et l'élongation

Big Numbers: a Concept Creationists Don't Understand

This video rests on one assumption, that mutations are a constant fact of life. Is this valid? Yes. Three common causes of mutations are radicals, ionizing radiation, and polymerase errors. Radicals are a constant given the chemistry of the earth. Ionizing radiations has existed long before life. And no polymerase is perfect. Therefore, mutations have occurred in the past and continue to occur today. To download this video go to: http://www.mediafire.com/?etw9jv1mu4n If you wish to translate this video you can download the PowerPoint file from: http://www.mediafire.com/?wny1z2dz1z1 Learn the facts, spread the truth, and most importantly, Think About It.

DNA Test Methods - DNA Sanger Sequencing

View the full Interactive Tutorial at: http://www.phgfoundation.org/tutorials/dna/5.html Once a piece of DNA has been amplified, it can be sequenced. In this process, four reaction mixtures are set up, each one including: 1. DNA to be sequenced 2. DNA polymerase 3. A supply of nucleotides (A, C, G and T) 4. A small amount of a labelled chain-terminating variant of one of the four nucleotides. The enzyme DNA polymerase incorporates a chain-terminating variant at random, eventually ending the chain at every possible nucleotide position over a few hundred bases. The products of the reaction mixtures are run on an electrophoresis gel, where the sequence can be deduced by reading from the smallest to the largest piece. If different fluorescent labels are used for the variant bases, sequencing can all be done in one single reaction, the bands can be detected and the sequence read out automatically. The entire process of DNA sample preparation and sequencing is now highly automated, a development that has been essential for the timely and cost-effective completion of the human genome project.

I Know My DNA Truth...Do You?

FREE INSIDER REPORT http://www.mydnatruth.com (406)595-2238 I know my DNA truth...Do you? We travel inside nucleus to see how the DNA replicates. When DNA replicates its strands are separated by enzine helicase. Single-stranded DNA binding proteines keep the strands from (...?). One DNA strand encodes the leading strand using DNA Polymerase III. Just watch to see what is going on. --- It's Never too Late to Study: FreeScienceLectures --- Notice: This video is copyright by its respectful owners. The website address on the video does not mean anything.

HIV Replication 3D Medical Animation

It is a very excellent animation which explains the hiv replication very clearly. For free download of this video please visit my webpage http://rufusrajadurai.wetpaint.com/ And other 3D animation videos visit http://rufusrajadurai.wetpaint.com/page/3D+Medical+Animation+Library Regards, Dr.Rufus The Lyrics of this video is here Targeting HIV replication The replication of HIV 1 is a multi-stage process. Each step is crucial to successful replication and is therefore a potential target of antiretroviral drugs. Step one is the infection of a suitable host-cell, such as a CD4-positive T-lymphocyte. Entry of HIV into the cell requires the presence of certain receptors on the cell surface, CD4 -- receptors and co-receptors such as CCR5 or CXCR4. These receptors interact with protein-complexes, which are embedded in the viral envelope. These complexes are composed of two glycoproteins: an extracellular gp 120 and a transmembrane gp 41 When HIV approaches the target cell gp120 binds to the CD4-receptors. This process is termed attachment. It promotes further binding to a co-receptor. Co-receptor binding results in a conformational change in gp120. This allows gp41 to unfold and insert its hydrophobic terminus into the cell membrane. Gp 41 then folds back on itself. This draws the virus towards the cell and facilitates the fusion of their membranes. The viral nucleocapsid enters the host cell and breaks open releasing two viral RNA-strands and 3 essential replication enzymes: Integrase, Protease and Reverse Transcriptase. Reverse Transcriptase begins the reverse transcription of viral RNA. It has two catalytic domains: The Ribonuclease-H active site And the polymerase active site Here single stranded viral RNA is transcribed into an RNA-DNA double helix. Ribonuclease- H breaks down the RNA. The polymerase then completes the remaining DNA-strand to form a DNA -- double helix. Now Integrase goes into action. It cleaves a dinucleotide from each 3-prime end of the DNA creating two sticky ends. Integrase then transfers the DNA into the cell nucleus and facilitates its integration into the host cell genome. The host cell genome now contains the genetic information of HIV. Activation of the cell induces transcription of proviral DNA into messenger RNA. The viral messenger RNA migrates into the cytoplasm where building blocks for a new virus are synthesised. Some of them have to be processed by the viral protease. Protease cleaves longer proteins into smaller core proteins. This step is crucial to create an infectious virus. Two viral RNA-strands and the replication enzymes then come together and core proteins assemble around them forming the capsid. This immature particle leaves the cell acquiring a new envelope of host and viral proteins. The virus matures and becomes ready to infect other cells. HIV replicates billions of times per day destroying the hosts` immune cells and eventually causing disease progression. Drugs which interfere with the key steps of viral replication can stop this fatal process. Entry into the host cell can be blocked by fusion inhibitors for example. Inhibition of reverse transcriptase by nucleoside inhibitors or by non-nucleoside Reverse Transcriptase- inhibitors is part of standard antiretroviral regimens. The action of Integrase can be blocked. Protease inhibitors are also part of standard antiretroviral therapy. Each blocked step in viral replication is a step towards better control of HIV disease. Script, Storyboard, Art Direction by: Frank Schauder, MD Animation: MACKEVISION Publicity: Dr.Rufus Rajadurai.MD.,D.DENS.,

Protein Synthesis Claymation

I know the animation and photo quality aren't all that great, but it took a while. I made it with JPEG video, a stop motion animation program and I edited it in Windows Movie Maker. It is 15 frames per second and 341 pictures. This video shows transcription of DNA to RNA and translation of RNA to a polypeptide. Here is a slightly more detailed explanation of what is happening because a few things had to be cut: The DNA polymerase (not shown in movie) unzips the DNA. Then the RNA forms, by matching each guanine (G) of the DNA to RNA's cytosine (C) and vice versa; and matching each thymine (T) to adenine (A); and each A to uracil (U). In the movie, T is red, C is brown, G is blue, A is yellow, and U is green. The movie doesn't show this, but the RNA is made by matching each nucleotide one at a time, instead of coming in fully formed as the movie depicts. The enzyme called RNA polymerase is what catalyzes this process, but that also isn't shown in the movie. The DNA goes back together in helix form and the mRNA (messenger RNA, which was just made) moves to the ribosome, an organelle. The ribosome is made up of protein and RNA called rRNA (ribosomal RNA). This is where translation begins. Only two codons (a section of RNA with three nucleotides) can fit in the ribosome at a time. The tRNA (transfer RNA), which are the brown crosses with nucleotides, come into the ribosome. The nucleotides on the bottom of the tRNA, called anti-codons, match the codons of the mRNA. Each tRNA is attached to a specific amino acid, which are the colored balls in the video. The type of amino acid is based on the codon on the mRNA that the tRNA matches. The codons in this video code for Valine, Aspartate, Threonine, Histidine, Tyrosine, and Phenylalanine. The last codon doesn't have a matching tRNA because it is a stop codon which signals for the translation process to stop. These amino acids bond through dehydration synthesis as the process continues to form a polypeptide, thus making protein. DNA code used in video that was transcribed: CAACTGTGTGTAATAAAGATC RNA code that was transcribed from above DNA and then translated: GUUGACACACAUUAUUUCUAG